DNA Barcoding of Locusta migratoria manilensis (Orthoptera: Acrididae) Reveals Insights into the Species and Subspecies Differentiation1
Accurate identification and classification of insect species, especially those with significant economic and ecological implications, have historically presented challenges. Migratory locusts, Locusta migratoria manilensis (Meyen) (Orthoptera: Acrididae), are notorious for their destructive impact on crops. Traditional morphological methods often face limitations in distinguishing closely related species and require taxonomic expertise. However, the emergence of DNA barcoding as a powerful tool for species identification has revolutionized the field of entomology. DNA barcoding utilizes a standardized DNA sequence, a molecular barcode, which serves as a distinct genetic signature for rapid and accurate species identification. In this study, DNA barcoding techniques were employed to identify and differentiate the migratory locust subspecies manilensis, in both its solitary and gregarious forms, as well as to determine its phylogenetic relationship with other related species within the Acrididae family. GenBank reference sequences were used to identify the locusts at the molecular subspecies level. Although the COI marker did not exhibit significant differences between the solitary and migratory forms, it was valuable in resolving the identification of L. migratoria subspecies. This lack of significant differences may be attributed to limited genetic variation of COI at the subspecies level and substantial genetic similarities between the solitary and migratory forms, likely stemming from a recent common ancestor. Nonetheless, using COI remains beneficial for subspecies identification in migratory locusts.Abstract
The Oriental migratory locust, Locusta migratoria manilensis (Meyen) (Orthoptera: Acrididae), is a major agricultural pest that has caused significant damage to crops such as wheat, maize, and rice, posing threats to food security and economic stability (Geng et al. 2020, Wang et al. 2022). This species is known for its swarming behavior and the challenges it presents in terms of control (Wang et al. 2022). Locust outbreaks have devastating consequences for agriculture (Geng et al. 2020). The migratory locust, Locusta migratoria L., can transition from a solitary form to a gregarious and migratory phase when population density increases (Du et al. 2021, Kamienkowski 2022). This transition involves significant genetic changes, including gene expression and translational profile alterations (Li et al. 2023). Differences in phase-related genes, flight traits, physiology, behavior, and reproduction have been observed between gregarious and solitary locusts (Guo et al. 2022, Lavy et al. 2019, Wang et al. 2022, Zhao et al. 2021).
DNA barcoding, utilizing the mitochondrial cytochrome c oxidase subunit I (COI) gene, has emerged as a valuable tool for identifying and classifying locust species, including the Oriental migratory locust, which belongs to a complex of closely related species that are difficult to differentiate based on morphology alone (Verlinden et al. 2020, Wang et al. 2022). DNA barcoding aids in species identification, population monitoring, and the study of locust dynamics and migration patterns, providing insights into their genetics, evolution, and ecological impact (Ni and Wu 2007, Tian et al. 2011). It overcomes the limitations of traditional morphological identification methods, allowing for reliable and efficient identification of migratory locusts (Baggerman et al. 2002, Iwata et al. 2005).
In this study, we aimed to utilize DNA barcoding to overcome the challenges of morphological identification methods and better understand the genetic diversity and distribution patterns of L. migratoria manilensis populations. This research will contribute to the development of targeted and sustainable pest management strategies.
Materials and Methods
Oriental migratory locust collection
Migratory locusts were collected in Bukidnon province of The Philippines, and their solitary and migratory forms were identified based on morphological observations. Differences were documented using a dissecting microscope and photos. Pinned specimens from previous collections also were obtained for molecular characterization. The samples were processed at the Molecular Laboratory of the National Crop Protection Center (NCPC) at the University of the Philippines, Los Baños.
DNA extraction, PCR amplification and sequence analysis
Genomic DNA isolation was performed using the Animal and Fungi DNA Preparation Kit (www.jenabioscience.com) with some modifications. Individual insects were extracted using the foreleg. The volume of the DNA purification reagents was adjusted proportionately. Cell lysis was conducted in 50 µl Cell Lysis Solution with 12 µg Proteinase K incubated for 1 h at 55°C. Protein contaminants were removed by adding Protein Precipitation Solution and centrifugation at 15,000 × g for 10 min. The DNA was precipitated using > 99% isopropanol and then collected by centrifugation at 15,000 × g for 15 min. The DNA pellet was washed twice with the Washing Buffer provided in the kit and resuspended at 37°C, then 65°C each for 1 h in the DNA Hydration buffer. The DNA samples were stored at −20°C until use.
The region of mitochondrial DNA (mtDNA) containing the cytochrome oxidase I (COI) gene was amplified using standard DNA barcoding primers LCO (GGTCAACAAATCATAAAGATATTGG) and HCO (TAAACTTCAGGGTGACCAAAAAATCA). The amplification conditions were 1 min at 94°C for denaturation, five cycles of 30 s at 94°C, 40 s at 45°C, and 60 s at 72°C, followed by 35 cycles of 30 s at 94°C, 40 s at 51°C, and 60 s at 72°C, and a final amplification of 10 min at 72°C. The resulting 680 bp amplicons were visualized through gel electrophoresis using a 1.0% agarose gel and Labnet Enduro Touch gel viewer (Fig. 1). Raw nucleotide sequences were processed using BioEdit Sequence Alignment Editor and aligned using Clustal W. The sequences were compared with those deposited in GenBank. Phylogenetic analysis of COI sequences of Locusta spp. was conducted using Maximum Likelihood with MEGA11 software (Kumar et al. 2021).
Citation: Journal of Entomological Science 59, 2; 10.18474/JES23-36
Results and Discussion
Morphological observations between collected solitary and migratory locusts
Morphological observations were conducted on the collected solitary and migratory locusts. Marked differences in body coloration were observed. Solitary locusts displayed a uniform green color, whereas gregarious locusts exhibited a distinct pattern of black dorsal and brown ventral surfaces. These findings are consistent with previous studies by Ding et al. (2021), Yang et al. (2019), and Kang et al. (2018). Additionally, solitary locusts were characterized by a shorter and convex pronotum.
In comparison, gregarious locusts had a longer and more depressed pronotum (Fig. 2). These morphological differences align with the biological characteristics associated with each locust phase, as Ding et al. (2021) reported. Observing body color changes is crucial for adapting to diverse environments (Yang et al. 2019). Furthermore, gregarious locusts exhibited distinct flight traits compared to solitary locusts, as documented by Ding et al. (2021).
Citation: Journal of Entomological Science 59, 2; 10.18474/JES23-36
Genetic identification of Philippine Oriental migratory locusts
The Philippine locust species exhibited a high similarity of 99% with L. migratoria manilensis (KC140016.1). Understanding genetic relationships and similarities among species is crucial for studying evolutionary patterns and biodiversity. We conducted pairwise sequence alignments between orthopteran species, focusing on the consensus sequences of the Philippine Oriental migratory locusts PHL-SC and PHL-MC, and compared them with L. migratoria manilensis (KC140016.1) and other locust genera. The results are presented in Table 1. Comparing Locusta PHL-MC and Locusta PHL-SC with L. migratoria manilensis (KC140016.1), we found a high level of similarity, with identities of 99.544% and 99.392%, respectively. This suggests a close genetic relationship between these two subspecies. Notably, L. migratoria (OQ214102.1 and OQ214110.1) exhibited only 96.960% identity with the Philippine locust, indicating genetic differences between the manilensis subspecies and the migratoria species. The pairwise sequence alignment results reveal interesting genetic similarity and divergence patterns among the analyzed orthopteran species.
Phylogenetic analysis of Philippine locusts species using COI
The molecular phylogenetic analysis of the Philippine locusts with other locust species and the field cricket, Gryllus bimaculatus DeGeer (Orthoptera: Gryllidae), as an outgroup was inferred using the Maximum Likelihood method based on the Tamura 3-parameter model (Tamura 2021). Evolutionary analyses were conducted in MEGA11, with 650 positions in the final data set (Fig. 3).
Citation: Journal of Entomological Science 59, 2; 10.18474/JES23-36
The phylogenetic tree reveals a close genetic relationship between L. migratoria manilensis and the Philippine locust species PHL-MC and PHL-SC. This observation suggests that these subspecies share a recent common ancestry or have undergone limited genetic divergence. On the other hand, the phylogenetic tree also indicates more significant genetic differentiation between different species and subspecies of L. migratoria, as evidenced by the formation of distinct branches for each subspecies. These findings suggest substantial genetic divergence between the L. migratoria complex.
Furthermore, the inclusion of Schistocerca gregaria gregaria (Forskal) (KU251465.1) and Gryllus bimaculatus (MW085273.1 and MW085767.1) in the phylogenetic tree highlights the genetic distinctions between different orthopteran genera. The phylogenetic tree provides valuable insights into the genetic relationships and divergence patterns among the analyzed locust species.
The phylogeny of locusts has been the subject of several studies (Song 2004, Song and Wenzel 2008, Song et al. 2017). These studies aim to understand the evolutionary history and relationships between locust species and their ability to exhibit density-dependent phenotypic plasticity (Song et al. 2017). By investigating the phylogeny of locusts, researchers gain insights into the evolution of the locust phase and the factors that contribute to their swarming behavior (Song 2011). Comparative analyses based on phylogenetic frameworks help researchers uncover the complex evolutionary patterns underlying locust phenotypic plasticity (Song et al. 2017). Studying the phylogeny of locusts is crucial for understanding their biology and ecology and developing effective strategies for locust management and control (Klein et al. 2021, Lavy et al. 2020a). Furthermore, studying locust phylogeny provides a foundation for investigating the microbial composition of locusts and their reproductive tracts (Lavy et al. 2020a, 2020b).
Understanding locust species morphological and genetic characteristics is essential for studying their evolutionary patterns, biology, and ecological adaptations. Our study contributes to the molecular data and phylogeny of migratory locust subspecies serving as baseline data for future work. Our results highlight the utility of COI for species resolution. Further studies, including comprehensive genomic analyses and functional studies, are needed to deepen our understanding of locust species genetic basis and adaptive traits.
Amplicon from the COI region, approximately 700 bp (lane 2-6) from Oriental migratory locust collected from Bukidnon. A 100 bp ladder, the first lane denoted as M (VC 100 bp Plus DNA Ladder, Vivantis, www.vivantechnologies.com), was used as a molecular size standard.
Marked difference between solitary and gregarious locusts. The pronotum of solitary (a) and migratory locust (b) are emphasized.
Evolutionary analysis by Maximum Likelihood method. Maximum Likelihood of locust species using the Kimura 2-parameter model (Kimura 1980) implemented in MEGA11 (Stecher et al. 2020, Tamura et al. 2021). This analysis used ten nucleotide sequences, including the Philippine locust consensus sequence, Locusta migratoria manilensis PHL-MC and PHL-SC boxed in green, and nine GenBank sequences (accessions).
Contributor Notes