Ash gourd, Benincasa hispida (Thunberg) Cogniaux (Cucurbitaceae), is widely cultivated throughout humid tropical and subtropical climates and is used as a vegetable in India and China. It is an excellent source of vitamin B1 (thiamine), a good source of vitamin B3 (niacin) and vitamin C, and also rich in many minerals like calcium. Its high potassium content makes this a preferred vegetable for maintaining a nutrient-rich diet.

The whitefly, Bemisia tabaci (Gennadius) (Homoptera: Aleyrodidae), is an agricultural pest in tropical and subtropical regions and has colonized plants in the greenhouses of semitemperate countries. Bemisia tabaci has increased in importance globally since the 1990s, as a serious pest of vegetable, fiber, and root crops (Duffus 1987, Otim-Nape et al. 1997, Polston and Anderson 1997, Varma and Malathi 2003). In addition to direct damage, it also vectors a number of plant viruses belonging to the family Geminiviridae (de Barro et al. 2011, Dinsdale et al. 2010). The whitefly was first collected and described as Aleyrodes tabaci (Gennadius) from tobacco, Nicotiana tabacum L., in Greece in 1889. It was subsequently renamed (Russell 1957) as B. tabaci and was found across the globe in the United States, Africa, Middle East, the Orient, Russia, China, Southeast Asia, and South America (Brown et al. 1995). Its geographical diversity and broad host range gave rise to several common names associated with host plants such as sweet potato whitefly, cotton whitefly, etc. Though whiteflies damage the crop through direct feeding, their major impact on agriculture is through the transmission of plant viruses (Brown et al. 1995). This problem is exacerbated by its polyphagous nature. It has a broad host range, with more than 600 different host plant species that include representatives from Solanaceae, Cucurbitaceae, Malvaceae, Fabaceae, Euphorbiaceae, and Asteraceae (Brown et al. 1995, Oliveira et al. 2001). Different populations of B. tabaci are morphologically indistinguishable but display distinctive biological, physiological, and genetic variation, and thus are deemed a cryptic species complex (Boykin et al. 2007, 2012; de Barro et al. 2011; Dinsdale et al. 2010; Tay et al. 2012). The B. tabaci complex consists of cryptic species that need to be differentiated and identified. As these cryptic species are morphologically indistinguishable, various molecular markers have been employed such as RAPD PCR (Gawel and Bartlett 1993, de Barro and Driver 1997), AFLP (Cervera et al. 2000), mitochondrial cytochrome oxidase gene subunit I (mtCOI) (Frohlich et al. 1999, Brown et al. 2000), and ribosomal ITS1 nucleotide sequence (de Barro et al. 2000). The most widely accepted method is differentiation on the basis of nucleotide sequence of mtCOI. Using mtCOI-based Bayesian phylogenetic analysis, Dinsdale et al. (2010) and de Barro et al. (2011) proposed a speciation system keeping 3.5% sequence divergence as threshold. Following these criteria, 34 species have been delimited at global level (Boykin 2014; Boykin et al. 2012, 2013). Whether these cryptic species could be differentiated on the basis of mating behavior, insecticide resistance, and transmission characteristics is being studied. In the present study, mtCOI gene nucleotide sequence was used to determine the genetic affiliation of B. tabaci populations (de Barro et al. 2011) occurring on ash gourd in Tamil Nadu, India.

Materials and Methods

Sample collection. Adults of B. tabaci were collected from 18 different locations covering four districts during a field survey conducted in major ash gourd–growing belts of Tamil Nadu. At each location, individual insect samples were collected in separate Eppendorf tubes containing 70% ethanol and stored in a freezer at –80°C until used.

DNA isolation. To extract the DNA from a single whitefly, the lysis method of DNA extraction was followed as per Zeidan and Czosnek (1991). A petri dish lid was covered with aluminum foil and Parafilm one on another. Then 5 µl of lysis buffer (5 µl of Tris HCl, 1 µl of EDTA, 5 µl of Triton X 100, 50 µl of proteinase K 20 mg/ml, and 939 µl of ddH₂O) was spotted on the surface of the lid covered with Parafilm. A single whitefly was placed on the buffer spot using a brush and crushed with the edge of polymerase chain reaction (PCR) tube. After crushing, the entire content was transferred into fresh PCR collection tube. In addition to this, the surface of the PCR tube that was used to crush the whitefly was washed with 35 µl of lysis buffer. The entire content was kept on ice for 5 min and incubated at 65°C for 15 min followed by 95°C for 10 min and placed immediately on ice. The contents were spun for 5 s, and the supernatant was processed for PCR.

mtCOI subunit I amplification. The mtCOI gene sequence was analyzed for whitefly samples collected from 18 locations for genetic identification. Approximately 800 bp of the mtCOI gene fragment was amplified using LCO1 1490 forward primer 5′ GGTCAACAAATCATAAAGATATTGG 3′ and HCO1 2198 reverse primer 5′ TAAACTTCAGGGTGACCAAAAAATCA 3′ (Folmer et al. 1994). The 25-µl reaction volume containing 12.5 µl of 2× smART master mix, Cat. No. 280311 (ready-made mix of Taq polymerase, dNTPs, and PCR buffer), 5 µl of template DNA (approximately 50 ng), 3.5 µl of sterile distilled water, and 2 µl of each forward and reverse primer (15 pg each). The PCR was performed with initial denaturation at 94°C for 3 min, followed by 40 cycles each consisting of denaturation for 30 s at 94°C, annealing for 40 s at 53°C with final extension for 1 min at 72°C, followed by final extension for 20 min at 72°C. The PCR products were gel purified and sequenced availing the commercial facility.

Sequence analysis. All mtCOI sequences corresponding to 34 different genetic groups of B. tabaci were downloaded from the National Center for Biotechnology Information (NCBI) GenBank (https://www.ncbi.nlm.nih.gov/Blast.cgi). Sequence alignment was performed employing MUSCLE implemented in Seaview (Thompson et al. 1994). Genetic divergence was calculated employing MEGA 7 using ClustalW (Tamura et al. 2013). The mtCOI DNA sequences generated in this study were submitted to the NCBI database.

Results

Genetic identification based on mtCOI. The genotype of the whitefly population collected from ash gourd in different locations of Tamil Nadu was identified by applying the taxonomic criteria of identity in the mtCOI. Of the 18 populations in the study, PCR amplicons were generated for 14 isolates using LCO1 and HCO1 primers. Amplicons of 800 bp were obtained for all the isolates that were sequenced (Fig. 1A, B). After confirming the whitefly origin of the sequence in the BLAST (Basic Local Alignment Search Tool) search, the sequences were trimmed and aligned with the sequences available for 34 genotypes of whitefly in the database (https://www.ncbi.nlm.nih.gov/Blast.cgi). The details on the sequences used in the analysis to identify the species are given in Table 2. When the sequences of about 605 bp (the maximum sequence which aligned) were compared, the whitefly populations TN1 Ja, TN2 Po, TN3 Ud, TN4 Ma, TN5 Ga, TN6 Co, TN9 Td, TN10 Gp, and TN11 El showed 99% identity with the Asia I genotype. The isolate TN12 Ap was slightly different though exhibited 99% identity with the Asia I genotype. Since all these whitefly populations revealed 99% identity with Asia I and the divergence being less than 3.5%, the threshold value kept for demarcation of the species (de Barro et al. 2011), these whitefly populations were recognized as belonging to the genotype Asia I. Contrastingly, the populations TN7 On and TN8 Er exhibited 92–99% identity with the Asia II 6 genotype. Again, according to de Barro et al. (2011), TN7 On and TN8 Er were recognized as belonging to Asia II 6 genotype (Table 3).

View Figure

• Download as Powerpoint
• Download Figure

Phylogenetic analysis. Grouping of the whitefly populations collected in the present study with Asia I genotype is further supported by the phylogenetic relationship analysis. A phylogenetic tree constructed on the basis of mtCOI nucleotide sequence (Fig. 2) clearly shows that the populations TN 14 Th, TN13 Cu, TN11 Eg, TN4 Ma, TN1 Ja, TN6 Co, TN2 Po, TN10 Gp, TN 3 Ud, TN5 Ga, and TN9 Td clustered with Asia I genotype. Although the population TN12 Ap belonged to Asia I, it branched off from Asia I due to substitutions in nucleotide sequence. In the tree, the two populations TN 7 On and TN8 Er grouped with the genotype Asia II 6. It is noteworthy that the Asia II 6 genotype has not yet been recorded in India. Presence of both genotypes within proximity of 2.8 km in the ash gourd fields indicates the presence of mixed population of whitefly genotypes in Tamil Nadu, even within limited geographic areas (Table 3).

View Figure

• Download as Powerpoint
• Download Figure

Discussion

The status of B. tabaci as a pest dates to 1889, but it received greater attention only from the 1980s as severe crop losses occurred in Israel and the United States. Bemisia tabaci is responsible for huge crop losses in both countries, and high levels of insecticide resistance and induced physiological changes in squash (Cucurbitaceae), named silver leafing, were observed. This population of whitefly showed an esterase pattern different from the population occurring in the United States. To differentiate these two populations, the indigenous population was designated as “A” and the one that caused severe damage as “B.” Since then, numerous studies were conducted to identify variants within and among whitefly populations. It is now accepted that B. tabaci consists of cryptic species that need to be differentiated and identified. Using mtCOI sequences, efforts have been made in India to identify the species of whitefly population (Ramappa et al. 1998). The diversity of whitefly genotypes, that is, Asia I, Asia II, Asia II 2, Asia II 5, Asia II 7, Asia II 8, MEAM 1, and China 3, is reported from different host plants in India (Table 1). It is interesting to note that so far Asia II 6 has not been reported in India, which has been recorded in the present study in two locations at Ongur and Eraiyur (TN7 On and TN8 Er; Table 3). Whether Asia II 6 is confined only to these two locations or is present throughout South India needs to be further investigated based on the record of whitefly populations in different crops in India, limited information is available on the cryptic species of whiteflies on cucurbit hosts. Prasanna et al. (2015) recorded Asia II 7 in cucumber, Cucumis sativus L., in Madhyapradesh, and Ellango et al. (2015) observed Asia II 1 in cucurbits in Jammu and Kashmir region. Roopa et al. (2015) recorded the whitefly cryptic species Asia I, Asia II 7, and Asia II 8 in the cucurbit crops, for example, Cucumis sativus, Citrullus lanatus (Thunberg) Matsumura and Nakai, Lagenaria siceraria (Molina) Standl, Luffa acutangula (L.) Roxburgh, Cucurbita pepo L., and Cucumis melo L., in Karnataka. It is surprising that, in contrast to the above observations, the Asia II 6 population of whiteflies was recorded on ash gourd in the present study for the first time in India. The transmission characteristics and insecticide resistance properties of this population need to be studied to contain the active spread of the disease vectored by this whitefly population.

Table 1 Diversity of whitefly genotypes reported from different host plants in India.

View Fullscreen

Table 2 GenBank accession numbers of whitefly genotype sequences retrieved from database for comparison.

View Fullscreen

Table 3 Diversity of whitefly genotypes in ash gourd in Tamil Nadu.*

View Fullscreen